DNA666 & EVENT201

Update: This is huge: J.H. Center, the one which organized Event-201 and the dynamic map, comes now with a new kind of vaccine anti-COVID-19; this one injects strains of RNA in your body; the classic vaccines injected only proteins similar to the virus envelope. And just RNA is necessary to inject a tiny foreign sequence in your DNA...

As we can see, this is the "end of the world" (as in Johns Revelation), which was not in 2012 (as they mistakenly translated from Maya) but in 2020. A small, insignificant error. Of course, the universe does not end, but only this civilization, from this galactic area ...  Everything seems SF, but it's SR (science-reality). That's why the most faithful priests have NO IDEA: 99,9 % are illiterate about such high-tech.

AND NOW, THE (LOOONG) STORY:

2. OVERPOPULATION

Surely, people overpopulate the planet today. Humans (as an animal species) are a strange phenomenon. Except for some monkeys, no big mammal has a monthly cycle, but annually (our reproduction is governed by the Moon / 28 days, not by the Sun). Thus humans are "designed" to multiply quickly. Atypical fast for their size!

Today we are (per kilogram taken) comparable to insects, which are the most numerous animals on the land. If a human has an average of 75 kg, insects "per kg" per person have 143 kg . No large mammal is even close to human numbers, except those we grow as food. Some make fewer children, naturally, as a reaction to "crowds" ... (some only 1.5 / woman )

When overpopulation occurs, the Bible says: "it is the time of the harvest" ( R 14:16 )

3. GROWTH LIMITS

In 1972 a book called " The Limits of Growth " was published. The authors are related to the Club of Rome. It is about growth versus limited resources; we cannot inflate the earth with a pump. And the Club of Rome is convinced that "the message still holds today" . Especially today!

But if the population continues to grow, driven by animal instincts, someone must die. That's the nature of things. And being many, many must die. We must give sacrifice to the God of Death (or Shiva by Indians or the Occultists). That is, " Malthusianism ": the overpopulation is wiped-out by disease and war, "naturally".

A first measure was the prohibition of DDT; thus (through mosquitoes + malaria) about 20 million died in Africa between 2004 and 2020. But this is not enough. Not war, but diseases are the best way to reduce the population. They are non-conflicting, discreet. "God" is to blame ... And they are "ecological", right? "Eco! - Rest in Elisyum greenfields"

4. GLOBALIZATION

Globalization (invented by socialists, see "International") is probably the scariest thing implemented in the last years; we depend on foreign production, the brains are heated by the internet, the money is "sucked" to the center. It's a castle from playing cards, which can fall down at once - that is, the whole globe!  That was the idea, after all! :)

In the Bible, globalization corresponds to the " Tower of Babel ". When you think you've got God on your feet the castle falls ... It's a symbol and nothing more, but it expresses EVERYTHING (no matter what you think about that book).

There have been some globalizations in history, though not written as such; the first was that of Al. Makedon who "opened the Pandora's box" towards "Silk Road". It ended badly with inflation and chaos.

Then, there is the "Gothic Renaissance" - between 1100 and 1320 Italians ate macaroni made in China (hence the custom in Italy). The Eurasian trade was intense, and the Europeans did nothing more than stumble on the roads, visit or conquer the "Holy Land". (Like today, with "traveling") It ended badly, in a pandemic> Black Death - in 80 years the population of Eurasia shrank to 50%.

5. PANDEMIC 1320

Let's see what happened back then, in the Middle-age. Were the diseases "natural", "from God" or are persons involved in the whole thing? Maybe a little of both!

It is a fact that nature will once react furiously to the destruction of the ecological balance, by the overpopulation of any species. But rather than expecting something unknown and uncontrollable, you better provoke something controllable in advance!

In order to control the fateful event, you need two things: be able to manipulate a pathogen, and to have protection: medications, vaccines. Does that seem impossible at the time?

You might be perplexed to hear that alchemists knew both the handling of pathogens (such as Yersinia pestis from animal corpses) and: vaccine (derived from acupuncture), antibiotics such as essential oils ( thieves blend ) + colloidal silver and even tetracycline beer (very effective against Yersinia bacteria). So VIPs were protected. And this is angular, in any "biological war". When you trigger, you must have an antidote, for yourself.

This was the case with Justinian's Plague, which came from the trade with Egypt - where cereals were produced, but where most ancient alchemists existed. This was exactly when Constantinople was preparing to conquer Rome / Papal Seat. In fact, the plague broke out exactly on those ships (541 AD). Coincidence, of course ...

The reason for the plague after the "Gothic Renaissance"? About 1312 AD Philip of France and Pope Clement (from Avignon) destroyed the Order of the Templars (read " The Damned Kings "). But because the Templars were the "de facto" bankers of Europe, the Silk Road (and its finances) fell into the hands of the Tartars, who had already conquered China (the place of production). Both Chinese and European secret societies would have been interested in destroying Tatar domination on this trade route. So under Tatar domination, China first had galloping inflation (paper money) and then plague (Yersinia Pestis). About 1320 it broke out, and then spread to Europe ... Survivors? 50%. "Silk Road" was closed for 500 years.

Why don't you know these? Because official history only cares about what "alpha male" beat another "alpha male" ... It's a history for "monkeys". Nothing is hidden, but it seems "unimportant" to the chairmen. Although, this is actually the real history.

6. PANDEMIC 2020

Today's conditions resemble perfectly with those from 1320, maintaining proportions. Globalization, a financial center, all the production of consumer goods in China, etc. In the role of Gingis-Han, is Putin (boogeyman). Of course, intense travel hysterized by ubiquitous advertising: "discover new cultures" ... Cultures where some people (because of overpopulation) eat insects and bats.

COVID-19 also broke out in China as did Yersinia-Pestis 700 years ago. Because between the 2 events are exactly 700 years ("7" is a number preferred by occultists)

There is only one question; is it possible for someone to be involved in "helping nature" today? A bacterium cannot be used, because we have antibiotics, and thus the outbreaks can be "controlled in advance". So the only usable ones are viruses. We don't have too many defenses against viruses - sometimes the preventive vaccine doesn't even work.

But let's dig deeper into the subject, with "the latest research." Because as I said to cause but also control an epidemic, you must have 2 elements: the pathogen and means of defense; medication for VIPs.

7. COVID-19 VIRUS

This virus is actually part of a fairly common family. Some respiratory diseases, colds, and bad pneumonia are caused by viruses from the "corona" family. The difference to this new COVID-19 is that it is more aggressive than the "ordinary" ones. And spread fast! That is, we are NOT "accustomed" to it - Each virus first killed thousands of people and the survivors left behind "resistant" outsprings. That's the way nature works.

We can see details on the "corona" page of Wikipedia. (which in this case is quite accurate). These corona are "enveloped viruses", meaning the RNA core is coated in a shell, as is the core in the nut.

We also know from Wikipedia that against these kinds of viruses the vaccine does not work always, it's quite hard to make a vaccine.

Also in an adjacent article, we see that bats are a "black sheep" as (possible) reservoir for this kind of viruses (as rats were for plague). Converse, if you want to genetically manipulate viruses, first you look for them in bats ...

Because there are not even vaccines, it seems that it cannot be used as an "extinction weapon" because VIPs are not protected! (I put this essential condition in advance, see above) The question is: do we really have no means of counteracting such viruses with all modern technology and genetic engineering? Hmmmm ...

8. CRISPR CAS13

Let's now get acquainted with a fantastic tool called CRISPR. Avoiding unintelligible technical details, it's like "scissors + sewing machine" for DNA. In other words, if you know what you're doing, you can modify the DNA as a tailor fixes or creates clothes. For example, you can cut the DNA from the yeast, and insert a "hem" with a gene that produces rare essential oils impossible to be made chemically. Or enzymes. Or peptides. Anything is possible ... You are like God (but only apparently ...).

You can inject a text from the Koran or Bible into the DNA ( translated into the AGCT DNA bases). You can also inject a mathematical ID in base64 that uses translated numbers and letters in AGCT. Carverr provides this technology.

This detail is angular because through it you can modify the DNA with the "Mark of the Beast". That is, a cryptographic blockchain hash inserted into the DNA. And this concerns not only Christians; anyone with altered DNA becomes "Zombie".

CRISPR-kit is sold "freely" and this is awful; no state can control the "monsters" that come out of the hands of a bad or even worse, insane tailor. But that's the situation.

In the first phase, this kit knew only how to manipulate DNA, which is specific to complex organisms and bacteria. But after 2016, it was supplemented with elements that can manipulate RNA (which is kind of "half a DNA"). Well, RNA is specific to viruses, including "corona"! RNA is their "DNA" coated in said "envelope".

In other words, you can manipulate something in those viruses. And with that, we have half the "proof". We know they CAN, and HOW they can be manipulated.

But we do not know yet if there is a specific medication for these viruses, easily modified. Well, there is! Last year (2019), scientists used CISPR CAS13 to create a method ( CARVER ) that kills new viruses in infected cells! And with this, we have the second condition: to have some VIP medication.

All "conspiracy" elements are met. It's just that they haven't been implemented ...

And now the really crazy story begins.

9. EVENT 201

On Friday, October 18, 2019, some important VIPs met at the ultra-luxury Pierre Hotel in New York to run a global simulation - Event 201 (link to the official site).

What did the guys simulate at that time, in that peaceful gathering?

A global pandemic, created by a coronavirus, transmitted from bats to pigs and humans ... (sound familiar?) The result of the simulation: 65 million deaths worldwide, and a 40% drop in the stock market. The epidemic is resolved after one year, a vaccine appears and then the virus becomes "harmless" like a childhood disease (measles).

If you haven't caught it yet, I mention that October 18, 2019 is 2 months before the first case of corona found in China - December 2019. So it's properly done: first, a simulation, to know what result you get. That's professional!

Who participates? No governments, and WHO is missing ... A bizarre mix of consortia through representatives + several organizations, including private ones; for example Bill Gates Foundation ( that with vaccines ) ... but also the World Economic Forum . All data is public here .

Among the participants are representatives of some companies: Hasti Taghi ( NBC & WEF ), Latoya D. Abbott ( Marriot Int. ), Martin Knuchel ( Lufthansa )

But also highly capable scientists. Specifically,   George F. Gao , Chairman of the Center for Disease Prevention and Control of China and President of the Microbiology Institute of China. He also researched at Harvard (those with CRISPR-CAS13, see above). And its field of research it's microbiology, enveloped viruses (inclusive corona). Everything starts to be transparent...

10. ID-2020

That COVID-19 was manipulated is clear to me. That some scientists have already made the medication for VIPs, it's clear too. But, sorry, why Bill Gates is involved in all this? That he wants to slap the stocks, has a logic. But even more interesting is the logic of combining a vaccine (of which Bill is very obsessed) with an electronic ID (identity card). A microchip injected together with the vaccine.

Of course, this is just a "conspiracy theory", because something like this simply cannot be. Seriously? Here's the ID-2020 Alliance, the official website. With vaccine + ID: Microsoft, Gavi (Vaccine Alliance) Rockefeller Foundation, the blockchain alliance Hyperledger (+ some media straw-people). Combine the compulsory vaccine with an injected microchip! ( already created by IBM) Explanation in English in this article. Or here. The name of the alliance shows that the schedule is fixed: 2020.

Now everything is clear:  controlled pandemic> mandatory vaccine> Bill puts the microchip in the vaccine> so in "our ass". Given the "state of emergency," you cannot refuse the vaccine because you "endanger public health"! What does health have in common with the microchip? ... Well, it's obvious: avoiding real cash you avoid infections. It's logical! In fact, without a pandemic, it would be impossible to justify such a thing. Well manipulated, what can I say...

It is clear what's about: Revelation 13:16 "That no one should be able to buy or sell without having the Mark of the Beast" ... etc. That is: implant. Faithful people! God help! So, for those who oppose the injection, the boys have already arranged in FEMA camps... 30,000 guillotines. Ordered by the US government in advance - à la Robespierre. This is the first death, Rev. 20: 6.

11. BLOCKCHAIN

Total surveillance by technology is a mathematical masterpiece called Blockchain. It's not just pure electronic money, that was created long ago in 1985 by Chaum. But that version was rejected, because it was not controllable "from the center"! Because the electronic money stayed with you on your computer, just like cash in your pocket!

The new "virtual currency" is not cash, but an immutable and unbreakable database. (details in English on this blog ) It's not cash or coin, because it's an account, and you don't own anything except the ID. (and the ID can be injected  into the DNA with CRISPR) It is "centralized" to the cloned banks called "miners " who spy each other electronically, to not falsify the data. The cloned ledger (banks) plays a key role here. The moneyless world dreamed of by the Bolsheviks. There are "unofficial" or some "official" versions authoritatively controlled. It is clear which variant will be implemented ...

"Blockchains" have appeared from nowhere, the creator is anonymous. Who knows what "alien" is Satoshi Nakamoto? And if he is an " alien " who knows what his intentions are? Or who knows what superior (perhaps quantum ) mathematics he used?

Anyway, the whole "conspiracy" jumped on this boat, to control every soul on Earth. To put them in "mathematical chains". Like Prometheus tied to the stone when the eagle ate his liver ... They like "chains", like for slaves...

12. CONCLUSIONS

We now know the following:

1. The Middle-age pandemics could be "helped" by alchemists with 2 conditions: to know how to handle the microbe (plague at that time, easy to extract from animal carcasses) and then to have a secret antidote for VIPs: tetracycline in beer, essential oils, silver, vaccine (documented in China in the year 1000)
2. Today we can modify the RNA of a virus using the CAS13 enzyme and the CRISPR kit. We can also generate enzymes that destroy the virus in the host cell, using the same CAS13- CARVER. So there might be an antidote for VIPs. Also with CAS13 (and by the same specialists from Harvard), the virus is being investigated. Also through CRISPR, a blockchain-ID (a hash) can be injected into the DNA, more precisely in the "non-coding" part called "junk". So you can inject "Beast's Sign".
3. Timing: In mid-2019, the virus antidote was discovered at Harward, with CAS13. On October 18, 2019, a pandemic with corona from bats was simulated. The simulation was attended by the head of Chinese microbiology who also worked with the Harward team and specializes in enveloped viruses. One central player was the Bill Gates Foundation, the one with compulsory vaccines. Then, the virus was launched in China.
4. On his foundation site, Gates says, "All lives have equal value. We are impatient optimists working to reduce inequity." We must admit that facing death, we are all equal. Bill knows what he's saying. And he has humor - even if gloomy ... (He wants to reduce inequity! What do you have against him?) ... See? This is the fate of American inventors. Edison started with the light bulb and ended up inventing the electric chair. This one produced an operating system ( copied from Gary Kildall) some windows ( copied from Apple) and ended up copying bat viruses ... to put microchips in the ass of the world (plagiarized after John 13:16 ). Bad plagiarism, because the barcode is 666.
5. The intended task is to enforce a mandatory vaccine, and with it an injected microchip, according to the ID-2020 Alliance.  Via vaccine, directly the code - into DNA. ... So everything, absolutely everything will be "digitalized" via Blockchain / Hyperledger. With the dextrogyre ID inside DNA - ( R 13:16 ). No money will be touched further, so nobody gets infected. He saved us! He is the "savior" (savior = soter, christ in Greek) ... He is also the anti-savior, because he has triggered the whole story. In Greek ... you know. Antichrist.

That's the outcome. God help!

13. WHAT COMES

We should understand why would be necessary to inject both the microchip and DNA-ID. For banking some electronics are clearly required; you can't make transactions with the DNA-ID. At the same time, the microchip can be removed relatively easily (a scalpel + local anesthetic, by the dentist). ... So having inserted the code directly into DNA, any falsification becomes impossible.

At the same time, a microchip can be "burned" by a microwave pulse. But you can still be identified via the DNA-ID; again a PCR test (just like for COVID now). Here another chapter of Revelation comes into play -  16: 2. "The first angel went and poured his bowl on the earth. A horrible, painful sore appeared on the people who had the mark of the beast and worshipped the image. "  A painful wound is when the  EM pulse burns and causes the microchip implant to explode.

Given that Rev 16 describes the preparation and conduct of the final war (Armaggeddon) we must say that the ionospheric EM pulse is a standard weapon in the case of world war. It does not kill the opponent, but it destroys its electronics, which is essential in modern warfare.

Consequence? All the small electronics will be burned; the implant, the mobile, a.s.o. Everything that is not protected in the Faraday cage. All the money being 100% digital at that time, everyone will run out of money. The total collapse will follow. Whoever somehow survives the famine will be forced to resort back to material money (metal, paper).

But the cloned systems of banks with blockchain (miners) will withstand, in their bunkers; that's why they are designed "cloned". So you can still be identified via DNA-ID. The Beast doesn't vanish! It's just that you have no money because all the peripherals are burned. And because the system can be restored through the cloned network from bunkers, that's why God must come and control the Beast directly.

14. NOTES

The Revelation:  Maybe you wonder how John from Patmos could know all these details 2000 years ago. It's simple; through time-travel. If we can do it in the near future, why not God itself! With the resurrection, it is harder for us. So the "cabbalistic, ignorant" text is completely true, and even scientific.

Beast:  Regarding the technology with INTERNET + CRISPR, think about this: A spider first builds a web (the internet). Then injects the trapped victims (internauts, meaning billions here) with a paralyzing peptide gastric juice (here CRISPR + blockchain-ID). The spider is the only being on Earth that digests prey outside his body ... and then "sucks it with a straw". Maybe it's an "alien-arachnid." Or maybe just a symbol, like  Arachne.  The one who competed and defied gods ... The  Son of Man is a Man, not an "insect" as seen by "those" conspirators.

About data centralization (including DNA cryptographic codes) it is good to know that the "web" - that is, the www protocol - was invented at CERN. There is also the TIER-zero server. - the other providers (of the highest rank) have only level TIER-one. Curiously, TIER means "BEAST" in German ... And www in Hebrew gematria = 666 (vav-vav-vav) see Amos 4: 2 - the letter vav resembles a hook. At CERN they are in preparation for a "pit" Overall, "coincidences". A 30 years salamy-slice constructed trap, for mankind.

Howto:  How can be made the "vaccine" with Blockchain-ID? "The Mark of the Beast"

A hash is generated, for example in  BITADRESS. I generated one:

Secret address:   L3mdJxXpHytepfpTaVVhufiqZagapvZDUv13x3HYBCiv3qygnuK4   Public address: 1E1z4xmjzQjnsk3QTVtmiPUZcQZyHUvBBi

The secret address is translated into ACGT - that is, the DNA bases - into  DNA-WRITER

ATCGTGACATACTGCAGTAGTGAGCGTGACTAGCTA GAGGCTGAGTAGACTGTAGTACGTGATGCTCTGTAT GCAACTGTCACTGAGGTAGCATACGATGTATCTGTG AGTGTGCGTGACCATTCACTGGTAGTGTATGACGTC CTCGATTCGAGA

This small sequence of genes is actually transposed by a machine like this: KILOBASER which practically "prints" the molecules. Microsoft (Bill Gates)  has a large-series device, as well as software for CRISPR - (CRISPR-ML)  Further, it can be multiplied with a cheap PCR device.

In order to read the gene sequence, you need a device like these:  NANOPORETECH  and possibly a cheap PCR device. Between steps 3 and 4, remains an essential step: injecting this small DNA sequence into the "noncoding-DNA".This can be done with CRISPR / SATI ( SATI # 2 ) via vaccine ( Vectorbuilder synthetic viruses ), in the immediate future (max. 3-4 years). But the first step is purely electronic, with the injected microchip.

Monocellular organisms or plants have already been "DNA-edited". You can see a GIF extracted from an edited bacterium. SATI allows "in vivo" insertion into non-coding DNA in mammals.

References: many people felt that "Mark of the Beast" would be somehow related to DNA modification, but the specifications were not clear because of the lack of data ... The technical solution is simple, as explained above. Search online for "Mark of the Beast DNA" and you find:

The Genetics of the Mark of the Beast - Amazon.com

How the Mark of the Beast Will Rewrite the Human Genome

VW: Mark of the Beast: a potential scenario?

26- Is The Mark of the Beast A DNA Change? – Prophecy Talk

CERN, DNA, and the Mark of the Beast | - Jim Duke Perspective

...etc., etc.